Kumaresan Ramanathan
Associate Professor
Faculty Member
Mekelle University (Ayder Campus)
Mekelle, Tigray Region Ethiopia
kumaresanramanatha@gmail.com
CV

Areas of Expertise:
Molecular Diagnostics

Research Organisms:
homosapiens

 

Research Focus:

1. Study on Regulation of Low Density Lipoprotein Cholesterol Metabolism using PCSK9 Gene Silencing

Initially we have done this study in computational approach and the results were quite interesting.
Background & Aim: With nearly 32.4 million people are affected every year with Myocardial infarction (MI), Cardiovascular Diseases (CVD) and strokes in chronic kidney disease (CKD) due to abnormal lipid metabolism. Combating and preventing abnormality in lipid metabolism becomes a pivotal criteria for research. Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a circulating protein, it promotes the degradation of low density lipoprotein receptors (LDL-R) and hence increases LDL-C levels. Mutations that block the secretion of PCSK9 reduce LDL-C level. Silencing the gene PCSK9 at the post-transcriptional level with the help of small interfering Ribo nucleic acid (siRNA) gives a new insight and a novel therapeutic way to regulate LDL-C metabolism. Designing and selecting an efficient siRNA for silencing PCSK9 mRNA through computational approach.
Method
We have designed seven siRNAs to silence the mRNA of PCSK9 through computational analysis. The designing of siRNA was done using a software Invivogen. After designing, their minimum free energy of hybridisation was evaluated and their hybridization structure obtained from the software BiBiServ. We also deduced that the binding efficiency varies with factors like linearity of mRNA, h-b index, low GC content of siRNA. Of all the factors h-b index of mRNA plays the most influential role in establishing a better knock down efficiency. If the mRNA has low h-b index, it tends to be more linear and hence binding of siRNA is more efficient.
Result
The minimum free energy of hybridization of the seven designed siRNA is as follows -22.7 kcal/mol, -32.4 kcal/mol, -29.1 kcal/mol, -27.5 kcal/mol, -23.0 kcal/mol, -22.9 kcal/mol, -24.8 kcal/mol.

Conclusion
siRNA2 having the least minimum free energy of hybridization i.e. -32.4 kcal/mol, is predicted to be the most efficient towards the PCSK9 gene silencing.

Plan
Further in vivo studies have to be carried out to confirm the knock down efficiency.

2. Evaluation of micro RNA Efficacy as Therapeutic Molecule in Transient Receptor Potential Channel 5 Gene Silencing

We have primarily approached this study in computational approach and the results were quite interesting.

Background & Aim: MicroRNA (miRNA) is an evolutionary conserved mechanism of gene regulation. Glomerular filter is crucial in sorting and preventing essential molecules from spilling into urine. Transient receptor potential channel 5 (TRPC5) intercede damage to filtration barrier that attributes to albuminuria, an indicator of cardiovascular, metabolic and chronic kidney disease. Inhibition of TRPC5 gene is a specific approach to protect glomerular filter barrier damage. Designing and selecting potential microRNA (miRNA) for TRPC5 gene silencing by computational analysis.
Materials & Methods: The mRNA sequence was retrieved from NCBI (National Center for Biotechnology Information). We have designed three miRNA sequences using Invivogen software. Gene silencing efficiency was assessed based on minimum free energy of hybridization and their hybridization structure was also obtained using BIBISERV2-RNA Hybrid. Further evaluation has been done using various factors like linearity of the mRNA-miRNA hybrid, h-b index and GC content of miRNA.
Results: The minimum free energy of hybridization of the three designed miRNA such as miRNA1,miRNA2 and miRNA3 are as follows : -28.2kcal/mol, -24.1 kcal/mol and-25.6 kcal/mol with their corresponding GC content are 47.62%,52.38% and 47.62% respectively. It was interpreted that binding efficiency was maximum with minimum free energy hybridization, comparatively high linearity of the mRNA-miRNA hybrid and low GC content of miRNA.
Conclusion: miRNA1 is having the least minimum free energy of hybridization i.e. -28.2 kcal/mol, with low GC content of 47.62%, high linearity with minimal h-b index and loop structure. This study predicts miRNA1 to be the most efficient in TRPC5 gene silencing.

Plan
To develop a potential therapeutic strategies (MiRNA) for treating glomerular filtration malfunction through in-vivo investigation to confirm their efficacy.
..
3. Amplification of Human Renalase Gene
Background & Aim: Renalase, is an enzyme with an activity of monoamine oxidase, metabolizes catecholamines. It circulates in the blood and regulates systemic blood pressure and cardiovascular functions. End stage renal disease (ESRD) patients have deficiency of renalase leading to hypertension. Patients without kidney disease also develop hypertension due to deficiency of renalase, making therapy with renalase inevitable. Cloning into expression vectors using recombinant DNA technology, large quantities of renalase can be produced in vitro which can be tried as therapeutic agent in cases of chronic kidney disease (CKD) and end stage renal disease (ESRD) patients. The study aimed to amplify the renalase gene (280bp) from human blood sample using polymerase chain reaction (PCR).

Materials and Method: Human renalase gene was amplified from genomic DNA isolated from human blood using kit method. Specific forward and reverse primers were designed and used along with master mix to amplify the human renalase gene. The genomic DNA and the amplified human renalase gene were checked on 1% agarose gel electrophoresis. The initial denaturation was done at 96 °C, annealing at 60 °C, and extension at 74 °C. The PCR was set for 28 cycles. The primers were designed using PRIMER 3 software.
Forward primer sequence: ATGCGACCCCAGGGCCCCGCCG
Reverse primer sequence: TTTTGGTAGTTCTTCAATAAG

Result: The genomic DNA was isolated from 5mL of human blood sample. PCR with specific forward and reverse primers with genomic DNA yielded human renalase gene having a size of 280base pairs and the number of copies of DNA obtained after 28 cycles is 26, 84, 35,456.

Conclusion: The human renalase was amplified from human blood using polymerase chain reaction and the same can be utilized for HT control in CKD patients.

Plan
To develop a recombinant Renalase for controlling hypertension in CKD populations.

Currently, we are working on the micro RNA (MiRNA) profiling for prediction of gene responsible for cardiac calcification in chronic kidney disease patients which will gives a platform for new drug discovery to target that particular gene.